Transcript: Mouse XM_017314981.1

PREDICTED: Mus musculus myelin transcription factor 1-like (Myt1l), transcript variant X31, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Myt1l (17933)
Length:
11776
CDS:
7101..9041

Additional Resources:

NCBI RefSeq record:
XM_017314981.1
NBCI Gene record:
Myt1l (17933)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314981.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429884 ATGAGTTGTACTCGAATAATG pLKO_005 2076 5UTR 100% 13.200 18.480 N Myt1l n/a
2 TRCN0000012112 CTCGGATATGATGAACCTTAT pLKO.1 2681 5UTR 100% 10.800 15.120 N Myt1l n/a
3 TRCN0000012108 CGGAACAGTGTTATGCTACAA pLKO.1 9135 3UTR 100% 4.950 6.930 N Myt1l n/a
4 TRCN0000012110 CGACAACCATACTTATGGCAA pLKO.1 7427 CDS 100% 2.640 2.112 N Myt1l n/a
5 TRCN0000416921 GTCCACACGTTGTCGTGAAAT pLKO_005 7691 CDS 100% 13.200 9.240 N Myt1l n/a
6 TRCN0000426489 ATGATGAGTATGATAACTATG pLKO_005 2125 5UTR 100% 10.800 7.560 N Myt1l n/a
7 TRCN0000012109 CGTGACTACTTTGACGGAAAT pLKO.1 8933 CDS 100% 10.800 7.560 N Myt1l n/a
8 TRCN0000012111 GCAAATATGCACGACACAGAA pLKO.1 1681 5UTR 100% 4.950 3.465 N Myt1l n/a
9 TRCN0000347067 AGAAGATGATGATGATGAATA pLKO_005 1970 5UTR 100% 13.200 6.600 Y Hmgb1-ps7 n/a
10 TRCN0000063714 GAAGAAGATGATGATGATGAT pLKO.1 1968 5UTR 100% 4.950 2.475 Y SET n/a
11 TRCN0000288612 GAAGAAGATGATGATGATGAT pLKO_005 1968 5UTR 100% 4.950 2.475 Y SET n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314981.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.