Transcript: Mouse XM_017315130.1

PREDICTED: Mus musculus extended synaptotagmin-like protein 2 (Esyt2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Esyt2 (52635)
Length:
13346
CDS:
142..2781

Additional Resources:

NCBI RefSeq record:
XM_017315130.1
NBCI Gene record:
Esyt2 (52635)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315130.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282951 GACCTTGAGGTTGAGGTTAAA pLKO_005 1810 CDS 100% 13.200 18.480 N Esyt2 n/a
2 TRCN0000374389 GTCTTATGATTGATCTTATTG pLKO_005 1325 CDS 100% 13.200 18.480 N Esyt2 n/a
3 TRCN0000282954 TACGCTGGACGTAGGTCTATT pLKO_005 2783 3UTR 100% 13.200 18.480 N Esyt2 n/a
4 TRCN0000264259 AGTCAATGGTGTTAAGGTTTA pLKO_005 657 CDS 100% 10.800 15.120 N Esyt2 n/a
5 TRCN0000374390 ATGGGACAATGCGGGTGATAC pLKO_005 803 CDS 100% 10.800 15.120 N Esyt2 n/a
6 TRCN0000264260 AGGAAATTGTGAGATTGATTT pLKO_005 732 CDS 100% 13.200 9.240 N Esyt2 n/a
7 TRCN0000374323 AGTCATGGGAGTCGATGATAA pLKO_005 2133 CDS 100% 13.200 9.240 N Esyt2 n/a
8 TRCN0000282969 GGCAAAGACACCTACCTTAAA pLKO_005 1108 CDS 100% 13.200 9.240 N Esyt2 n/a
9 TRCN0000135531 CTGAAAGAGCAGAATGGCTAA pLKO.1 488 CDS 100% 4.050 2.835 N ESYT2 n/a
10 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 6317 3UTR 100% 4.050 2.025 Y Mtif2 n/a
11 TRCN0000182716 CCTGAGTTCAATTCCCAGCAA pLKO.1 12506 3UTR 100% 2.640 1.320 Y BC028528 n/a
12 TRCN0000201143 CCAAAGGTCCTGAGTTCAAAT pLKO.1 12498 3UTR 100% 13.200 6.600 Y Ptcra n/a
13 TRCN0000136382 CACCTGTAATTCCAGCACTTT pLKO.1 9416 3UTR 100% 4.950 2.475 Y CENPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315130.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.