Transcript: Mouse XM_017315279.1

PREDICTED: Mus musculus zinc finger protein 124-like (LOC108167321), mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
LOC108167321 (108167321)
Length:
1974
CDS:
418..885

Additional Resources:

NCBI RefSeq record:
XM_017315279.1
NBCI Gene record:
LOC108167321 (108167321)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315279.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243551 CAAGAAGAAATGAAAGGTTTA pLKO_005 716 CDS 100% 10.800 5.400 Y Gm9222 n/a
2 TRCN0000243549 CCCAGAAGAGTCTCTACAAAG pLKO_005 611 CDS 100% 10.800 5.400 Y Gm9222 n/a
3 TRCN0000095843 GAGGATGCAGTGACTTATGAT pLKO.1 541 CDS 100% 5.625 2.813 Y 2410018L13Rik n/a
4 TRCN0000095842 GACATTGTCAAAGTTCAAGAA pLKO.1 701 CDS 100% 4.950 2.475 Y 2410018L13Rik n/a
5 TRCN0000093238 GAGTCTCTACAAAGATGTGAT pLKO.1 618 CDS 100% 4.950 2.475 Y Gm4983 n/a
6 TRCN0000096025 GTGACTTATGATGATGTGCAT pLKO.1 550 CDS 100% 2.640 1.320 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315279.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.