Transcript: Mouse XM_017315362.1

PREDICTED: Mus musculus Rho guanine nucleotide exchange factor (GEF) 28 (Arhgef28), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgef28 (110596)
Length:
4379
CDS:
91..4245

Additional Resources:

NCBI RefSeq record:
XM_017315362.1
NBCI Gene record:
Arhgef28 (110596)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315362.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433755 GCAAAGCTCTCGGCTTAATTA pLKO_005 2216 CDS 100% 15.000 21.000 N Arhgef28 n/a
2 TRCN0000422987 GCGATTTGGATATCAACTATA pLKO_005 293 CDS 100% 13.200 18.480 N Arhgef28 n/a
3 TRCN0000110062 CGGAACAAATCTAAGATGAAA pLKO.1 1039 CDS 100% 5.625 7.875 N Arhgef28 n/a
4 TRCN0000110063 GCCTCCGTGTACCAAGAAATT pLKO.1 1227 CDS 100% 13.200 9.240 N Arhgef28 n/a
5 TRCN0000110060 CCTCTGATTGTGTGGCCATTT pLKO.1 4239 CDS 100% 10.800 7.560 N Arhgef28 n/a
6 TRCN0000110061 GCCAAGATTCAGCAATGTCAA pLKO.1 2770 CDS 100% 4.950 3.465 N Arhgef28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315362.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.