Transcript: Mouse XM_017315364.1

PREDICTED: Mus musculus adhesion G protein-coupled receptor V1 (Adgrv1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adgrv1 (110789)
Length:
19308
CDS:
16..18993

Additional Resources:

NCBI RefSeq record:
XM_017315364.1
NBCI Gene record:
Adgrv1 (110789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315364.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028726 CGGCTACTGAAGGTTTAGATT pLKO.1 7973 CDS 100% 5.625 7.875 N Adgrv1 n/a
2 TRCN0000028683 GCCGGATACTACTCTTGTCTT pLKO.1 1071 CDS 100% 4.950 6.930 N Adgrv1 n/a
3 TRCN0000028752 CCACCAATGATAGACTTTATA pLKO.1 3973 CDS 100% 15.000 10.500 N Adgrv1 n/a
4 TRCN0000028686 CCACCGTATTTCCCACCTAAT pLKO.1 6154 CDS 100% 10.800 7.560 N Adgrv1 n/a
5 TRCN0000028700 CGGAGTTGAATGAAACTGTAA pLKO.1 2303 CDS 100% 4.950 3.465 N Adgrv1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315364.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.