Transcript: Mouse XM_017315447.1

PREDICTED: Mus musculus ryanodine receptor 2, cardiac (Ryr2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ryr2 (20191)
Length:
16881
CDS:
495..15464

Additional Resources:

NCBI RefSeq record:
XM_017315447.1
NBCI Gene record:
Ryr2 (20191)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315447.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102840 CCGCTAATGAAGCCATATAAA pLKO.1 8784 CDS 100% 15.000 21.000 N Ryr2 n/a
2 TRCN0000102843 CGTGATATAATCCGCAGTAAT pLKO.1 11037 CDS 100% 13.200 18.480 N Ryr2 n/a
3 TRCN0000419216 GATCCGATTTGTGGACTATAA pLKO_005 10640 CDS 100% 13.200 18.480 N Ryr2 n/a
4 TRCN0000102841 GCAGGAATAAAGGTTCGCTTT pLKO.1 2880 CDS 100% 4.050 5.670 N Ryr2 n/a
5 TRCN0000413349 AGCATCTCGTTTCGCATTAAT pLKO_005 2787 CDS 100% 15.000 12.000 N Ryr2 n/a
6 TRCN0000434347 ATGAGCCATTTGCCGTTAATA pLKO_005 4201 CDS 100% 15.000 10.500 N Ryr2 n/a
7 TRCN0000102842 CCCAATAACTACTGGGATAAA pLKO.1 14481 CDS 100% 13.200 9.240 N Ryr2 n/a
8 TRCN0000102844 GCTGCCAAAGACCTACACTAT pLKO.1 6824 CDS 100% 4.950 3.465 N Ryr2 n/a
9 TRCN0000144995 GAAGAGGATGAAGAAGATGAA pLKO.1 13382 CDS 100% 4.950 2.475 Y ARMH4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315447.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.