Transcript: Mouse XM_017315600.1

PREDICTED: Mus musculus phenylalanine-tRNA synthetase 2 (mitochondrial) (Fars2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fars2 (69955)
Length:
1749
CDS:
408..1637

Additional Resources:

NCBI RefSeq record:
XM_017315600.1
NBCI Gene record:
Fars2 (69955)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315600.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262549 GAGTTATTTGCTGGCGTAAAG pLKO_005 1017 CDS 100% 10.800 15.120 N Fars2 n/a
2 TRCN0000262551 GCGATCCAGGACACCTCTATT pLKO_005 716 CDS 100% 13.200 10.560 N Fars2 n/a
3 TRCN0000076316 GAACTTTGATAGCCTGCTAAT pLKO.1 779 CDS 100% 10.800 8.640 N Fars2 n/a
4 TRCN0000222654 CCGTGTTCAATGACATTTCAT pLKO.1 1492 CDS 100% 5.625 4.500 N Fars2 n/a
5 TRCN0000328413 CACCCTCTGTGGCTGATTAAG pLKO_005 657 CDS 100% 13.200 9.240 N Fars2 n/a
6 TRCN0000262550 TTGCTGCATGCGGGACTTAAT pLKO_005 894 CDS 100% 13.200 9.240 N Fars2 n/a
7 TRCN0000076317 GCTTGTGGAGTTCGACCTTAA pLKO.1 1118 CDS 100% 10.800 7.560 N Fars2 n/a
8 TRCN0000282322 TTGTGGTAGGTGACGTGTATC pLKO_005 922 CDS 100% 10.800 7.560 N Fars2 n/a
9 TRCN0000222656 CCAGATTGATTGCCAGCACTA pLKO.1 950 CDS 100% 4.050 2.835 N Fars2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315600.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.