Transcript: Mouse XM_017315604.1

PREDICTED: Mus musculus cancer antigen 1 (Cage1), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cage1 (71213)
Length:
2719
CDS:
196..2682

Additional Resources:

NCBI RefSeq record:
XM_017315604.1
NBCI Gene record:
Cage1 (71213)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315604.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252282 ACGTGTTGGTTGATATCATAA pLKO_005 1163 CDS 100% 13.200 18.480 N Cage1 n/a
2 TRCN0000215341 CGTGTTGGTTGATATCATAAA pLKO.1 1164 CDS 100% 13.200 18.480 N Cage1 n/a
3 TRCN0000252283 GCGACTCTTAAAGAGTTAATT pLKO_005 2149 CDS 100% 15.000 10.500 N Cage1 n/a
4 TRCN0000217541 CACTGGATAGAAGCGTTTAAC pLKO.1 385 CDS 100% 13.200 9.240 N Cage1 n/a
5 TRCN0000252281 CACTGGATAGAAGCGTTTAAC pLKO_005 385 CDS 100% 13.200 9.240 N Cage1 n/a
6 TRCN0000252280 GCGCTTACAGGAAAGGTATAT pLKO_005 1374 CDS 100% 13.200 9.240 N Cage1 n/a
7 TRCN0000252279 GGTGAACATTGAGGAGTTAAT pLKO_005 1194 CDS 100% 13.200 9.240 N Cage1 n/a
8 TRCN0000191051 CCAGATCCATTTAAGGAAGAA pLKO.1 508 CDS 100% 4.950 3.465 N Cage1 n/a
9 TRCN0000190376 CGGAAATTGAAGTCGAGAGTT pLKO.1 1627 CDS 100% 4.950 3.465 N Cage1 n/a
10 TRCN0000191788 GCAGCCTGATAAATAAGGTAA pLKO.1 2441 CDS 100% 4.950 3.465 N Cage1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315604.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.