Transcript: Mouse XM_017315651.1

PREDICTED: Mus musculus HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1 (Hecw1), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hecw1 (94253)
Length:
9336
CDS:
476..5125

Additional Resources:

NCBI RefSeq record:
XM_017315651.1
NBCI Gene record:
Hecw1 (94253)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315651.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429808 GACCTGGGAGCTGACTAATTT pLKO_005 5562 3UTR 100% 15.000 10.500 N Hecw1 n/a
2 TRCN0000419560 GTGATGCAGATCTAGTCATTT pLKO_005 3798 CDS 100% 13.200 9.240 N Hecw1 n/a
3 TRCN0000431449 TGGATTGGCATGTACCTTATT pLKO_005 743 CDS 100% 13.200 9.240 N Hecw1 n/a
4 TRCN0000087054 CCCGACCCTTATCTGAAGATT pLKO.1 1085 CDS 100% 5.625 3.938 N Hecw1 n/a
5 TRCN0000087056 CCAGAGAAACAAGCTCTACAT pLKO.1 4129 CDS 100% 4.950 3.465 N Hecw1 n/a
6 TRCN0000087057 CCCAGACCAATTCCACAACAT pLKO.1 544 CDS 100% 4.950 3.465 N Hecw1 n/a
7 TRCN0000087053 GCCAAGTTTATTTACGTGATA pLKO.1 6073 3UTR 100% 4.950 3.465 N Hecw1 n/a
8 TRCN0000087055 GCTCCGCAATTTCTACCGAAA pLKO.1 3994 CDS 100% 4.050 2.835 N Hecw1 n/a
9 TRCN0000186202 CAAGAAGCACAAACTTGTGTT pLKO.1 5859 3UTR 100% 4.950 2.475 Y Gm5726 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315651.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.