Transcript: Mouse XM_017315669.1

PREDICTED: Mus musculus hemolytic complement (Hc), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hc (15139)
Length:
5522
CDS:
119..5173

Additional Resources:

NCBI RefSeq record:
XM_017315669.1
NBCI Gene record:
Hc (15139)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315669.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420938 GCACGACTCCTGGTCTATTAC pLKO_005 1742 CDS 100% 13.200 10.560 N Hc n/a
2 TRCN0000067070 CCTCCCATGCAGTAATGGATA pLKO.1 4398 CDS 100% 4.950 3.960 N Hc n/a
3 TRCN0000067068 GCCTAGAATCAGATACACTTT pLKO.1 5241 3UTR 100% 4.950 3.960 N Hc n/a
4 TRCN0000427131 AGAACCTTCATTGGCTATAAA pLKO_005 833 CDS 100% 15.000 10.500 N Hc n/a
5 TRCN0000419276 TCTGGATTCAAGCGCATAATA pLKO_005 4331 CDS 100% 15.000 10.500 N Hc n/a
6 TRCN0000067071 CCTTCTCTTCAGGCTATGTTA pLKO.1 324 CDS 100% 5.625 3.938 N Hc n/a
7 TRCN0000067069 GCCACGATTCTCTGTTTCAAT pLKO.1 802 CDS 100% 5.625 3.938 N Hc n/a
8 TRCN0000067072 CCCATTATCGTGATGACTCTT pLKO.1 2118 CDS 100% 4.950 3.465 N Hc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315669.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.