Transcript: Mouse XM_017315716.1

PREDICTED: Mus musculus double homeobox B-like 3 (Duxbl3), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Duxbl3 (100039293)
Length:
3141
CDS:
1338..2390

Additional Resources:

NCBI RefSeq record:
XM_017315716.1
NBCI Gene record:
Duxbl3 (100039293)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315716.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428591 ACTCCGTAGCAGTAGGTTTAA pLKO_005 2382 CDS 100% 13.200 6.600 Y Duxbl1 n/a
2 TRCN0000422102 CAAAGTTCCAGACTGATATTC pLKO_005 1642 CDS 100% 13.200 6.600 Y Duxbl1 n/a
3 TRCN0000433381 CCCAGAATCCAGGATTCATAT pLKO_005 1736 CDS 100% 13.200 6.600 Y Duxbl1 n/a
4 TRCN0000071835 CGGCATCTCTGAGTCTCAAAT pLKO.1 1490 CDS 100% 13.200 6.600 Y Duxbl1 n/a
5 TRCN0000071833 GCAGGATAAACCTAGAGTTAA pLKO.1 1592 CDS 100% 13.200 6.600 Y Duxbl1 n/a
6 TRCN0000413657 TCGGTTCCCTGGGATTGTTAC pLKO_005 1685 CDS 100% 10.800 5.400 Y Duxbl1 n/a
7 TRCN0000071837 CCGCGCTTAGAAGATTGTACT pLKO.1 2163 CDS 100% 4.950 2.475 Y Duxbl1 n/a
8 TRCN0000071834 GCTGAATGGATGCCTGACAAA pLKO.1 2277 CDS 100% 4.950 2.475 Y Duxbl1 n/a
9 TRCN0000071836 GCTTCAGTTATACTGCCTCTT pLKO.1 1896 CDS 100% 4.050 2.025 Y Duxbl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315716.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.