Transcript: Mouse XM_017316082.1

PREDICTED: Mus musculus K(lysine) acetyltransferase 6B (Kat6b), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kat6b (54169)
Length:
8655
CDS:
889..7050

Additional Resources:

NCBI RefSeq record:
XM_017316082.1
NBCI Gene record:
Kat6b (54169)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316082.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222166 GCACGGACTTTAACGATGCAA pLKO.1 6694 CDS 100% 3.000 4.200 N KAT6B n/a
2 TRCN0000039343 CCACAGTCAGTTTCCATTAAA pLKO.1 4192 CDS 100% 15.000 10.500 N Kat6b n/a
3 TRCN0000287544 CCACAGTCAGTTTCCATTAAA pLKO_005 4192 CDS 100% 15.000 10.500 N Kat6b n/a
4 TRCN0000245351 ATGGAAATGCCTCTAACTTTA pLKO_005 7928 3UTR 100% 13.200 9.240 N KAT6B n/a
5 TRCN0000039341 CCCACAGGAATATGCAAGATT pLKO.1 3102 CDS 100% 5.625 3.938 N Kat6b n/a
6 TRCN0000287461 CCCACAGGAATATGCAAGATT pLKO_005 3102 CDS 100% 5.625 3.938 N Kat6b n/a
7 TRCN0000039340 CCTGTGATAGAGGATTCCATA pLKO.1 1760 CDS 100% 4.950 3.465 N Kat6b n/a
8 TRCN0000222167 CCACCTACATTTCTGCCTCTA pLKO.1 2141 CDS 100% 4.050 2.835 N KAT6B n/a
9 TRCN0000039339 CCGTGTAATGATCTACGCAAT pLKO.1 1183 CDS 100% 4.050 2.835 N Kat6b n/a
10 TRCN0000039342 CCATTAAGTAACACAGGGCTT pLKO.1 6382 CDS 100% 2.160 1.512 N Kat6b n/a
11 TRCN0000287463 CCATTAAGTAACACAGGGCTT pLKO_005 6382 CDS 100% 2.160 1.512 N Kat6b n/a
12 TRCN0000294917 GTCGTGCCTGCTTCCATTAAA pLKO_005 7339 3UTR 100% 15.000 9.000 N Kat6b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316082.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.