Transcript: Mouse XM_017316449.1

PREDICTED: Mus musculus kinesin family member 21A (Kif21a), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kif21a (16564)
Length:
8600
CDS:
2461..7425

Additional Resources:

NCBI RefSeq record:
XM_017316449.1
NBCI Gene record:
Kif21a (16564)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316449.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304951 TTGCCGGGAAAGACGATAATG pLKO_005 4160 CDS 100% 13.200 18.480 N Kif21a n/a
2 TRCN0000112897 CCTCATTATGATGGGATAGAA pLKO.1 7021 CDS 100% 5.625 7.875 N Kif21a n/a
3 TRCN0000112896 GCTAACTATCAAGCCGACTTA pLKO.1 4372 CDS 100% 4.950 6.930 N Kif21a n/a
4 TRCN0000315557 GCTAACTATCAAGCCGACTTA pLKO_005 4372 CDS 100% 4.950 6.930 N Kif21a n/a
5 TRCN0000112895 CGCAACTGATAATAAGCTGAT pLKO.1 3225 CDS 100% 4.050 5.670 N Kif21a n/a
6 TRCN0000308303 CGCAACTGATAATAAGCTGAT pLKO_005 3225 CDS 100% 4.050 5.670 N Kif21a n/a
7 TRCN0000304989 CTCAATCCATGGCTAGATAAT pLKO_005 7530 3UTR 100% 13.200 10.560 N Kif21a n/a
8 TRCN0000112898 CCCAGAAAGAGGCTCAAATTA pLKO.1 5618 CDS 100% 15.000 10.500 N Kif21a n/a
9 TRCN0000112899 GCCCAGAAAGAGGCTCAAATT pLKO.1 5617 CDS 100% 13.200 9.240 N Kif21a n/a
10 TRCN0000315486 GCCCAGAAAGAGGCTCAAATT pLKO_005 5617 CDS 100% 13.200 9.240 N Kif21a n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1997 5UTR 100% 4.950 2.475 Y KAAG1 n/a
12 TRCN0000093081 GATGAGGAAGAGGAGGAAGAA pLKO.1 4279 CDS 100% 4.950 2.475 Y Gm5518 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316449.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.