Transcript: Mouse XM_017316623.1

PREDICTED: Mus musculus grainyhead-like 2 (Drosophila) (Grhl2), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Grhl2 (252973)
Length:
2047
CDS:
144..1673

Additional Resources:

NCBI RefSeq record:
XM_017316623.1
NBCI Gene record:
Grhl2 (252973)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316623.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084223 CGGAGAAATTTCGGAGTACTT pLKO.1 1039 CDS 100% 4.950 6.930 N Grhl2 n/a
2 TRCN0000084226 CGCATACAATGCTGTTTCCTT pLKO.1 1415 CDS 100% 3.000 2.400 N Grhl2 n/a
3 TRCN0000310950 CCAGTGAAGCCCAGATCAATT pLKO_005 664 CDS 100% 13.200 9.240 N Grhl2 n/a
4 TRCN0000084225 CCTCAACAAAGGACAATTCTA pLKO.1 1172 CDS 100% 5.625 3.938 N Grhl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316623.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04157 pDONR223 100% 53.9% 56.2% None (many diffs) n/a
2 ccsbBroad304_04157 pLX_304 0% 53.9% 56.2% V5 (many diffs) n/a
Download CSV