Transcript: Mouse XM_017316721.1

PREDICTED: Mus musculus sodium channel, voltage-gated, type III, alpha (Scn3a), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Scn3a (20269)
Length:
8459
CDS:
313..6165

Additional Resources:

NCBI RefSeq record:
XM_017316721.1
NBCI Gene record:
Scn3a (20269)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316721.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068944 GCTGCTATCATTCAGCGTAAT pLKO.1 5887 CDS 100% 10.800 15.120 N Scn3a n/a
2 TRCN0000068973 CCCTACTACGTCAGTAAGAAA pLKO.1 556 CDS 100% 5.625 7.875 N Scn3a n/a
3 TRCN0000068945 GCAAATACATGACCCTGGTTT pLKO.1 4829 CDS 100% 4.950 6.930 N Scn3a n/a
4 TRCN0000173793 CGGGCGTAGTTGAAATAAGCA pLKO.1 3332 CDS 100% 3.000 4.200 N Scn3a n/a
5 TRCN0000068976 CTCGAGAATCTCTTGCTGCTA pLKO.1 365 CDS 100% 0.000 0.000 N Scn3a n/a
6 TRCN0000068943 GCCTATGGATTTCAAACCTAT pLKO.1 3958 CDS 100% 4.950 3.960 N Scn3a n/a
7 TRCN0000068974 CCCAAGAAAGAACAAGACATT pLKO.1 421 CDS 100% 4.950 3.465 N Scn3a n/a
8 TRCN0000068946 GAAAGTTCTATCACTGTGTTA pLKO.1 4253 CDS 100% 4.950 3.465 N Scn3a n/a
9 TRCN0000175723 GCAAAGAGCTTAACTACCTTA pLKO.1 3350 CDS 100% 4.950 3.465 N Scn3a n/a
10 TRCN0000175780 GCCTTATTGTTGAGTTCCTTT pLKO.1 3115 CDS 100% 4.950 3.465 N Scn3a n/a
11 TRCN0000068977 TGTAGTGTTGAATAAAGGGAA pLKO.1 582 CDS 100% 2.640 1.848 N Scn3a n/a
12 TRCN0000175527 CCATGTGCCTTATTGTGTTTA pLKO.1 3047 CDS 100% 13.200 7.920 N Scn3a n/a
13 TRCN0000068975 GCTGGGAAGAACCTTCCATTT pLKO.1 481 CDS 100% 10.800 5.400 Y Scn3a n/a
14 TRCN0000173545 GCTGTTTGGAAAGAGCTACAA pLKO.1 2880 CDS 100% 4.950 2.475 Y Scn3a n/a
15 TRCN0000173685 CCAGTTCATAGAGTTCTGCAA pLKO.1 5592 CDS 100% 2.640 1.320 Y Scn9a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316721.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.