Transcript: Mouse XM_017316726.1

PREDICTED: Mus musculus sorting nexin 31 (Snx31), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Snx31 (66696)
Length:
2402
CDS:
102..1418

Additional Resources:

NCBI RefSeq record:
XM_017316726.1
NBCI Gene record:
Snx31 (66696)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316726.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177969 GATCCGAAGGTGACTATGTTT pLKO.1 1369 CDS 100% 5.625 7.875 N Snx31 n/a
2 TRCN0000176534 CCAAAGTAGATTCACCAGATT pLKO.1 1766 3UTR 100% 4.950 6.930 N Snx31 n/a
3 TRCN0000177468 GCATTAAAGTAGAAGGTCTAA pLKO.1 484 CDS 100% 4.950 6.930 N Snx31 n/a
4 TRCN0000198305 GCTGCTGTATAACTTTGCCTA pLKO.1 994 CDS 100% 2.640 3.696 N Snx31 n/a
5 TRCN0000177239 GCACACATTGAATATCACCAT pLKO.1 422 CDS 100% 2.640 2.112 N Snx31 n/a
6 TRCN0000178070 GCCAGCAGTGGTTTGTTATTT pLKO.1 1162 CDS 100% 15.000 10.500 N Snx31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316726.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.