Transcript: Mouse XM_017316767.1

PREDICTED: Mus musculus spermatogenesis and centriole associated 1 (Spatc1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spatc1 (74281)
Length:
2139
CDS:
1501..2055

Additional Resources:

NCBI RefSeq record:
XM_017316767.1
NBCI Gene record:
Spatc1 (74281)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316767.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201412 CAGTCAAATGACTAGTCCCAT pLKO.1 1033 5UTR 100% 0.000 0.000 N Spatc1 n/a
2 TRCN0000181048 CTCCAACATCCCAGAGAAGAT pLKO.1 1698 CDS 100% 4.950 3.465 N SPATC1 n/a
3 TRCN0000202306 GATGGAACAGTCTCGGAAGAA pLKO.1 1500 5UTR 100% 4.950 3.465 N Spatc1 n/a
4 TRCN0000202487 GTCTGGCCAAATACCCTTGTT pLKO.1 886 5UTR 100% 4.950 3.465 N Spatc1 n/a
5 TRCN0000202291 GCAACCAACTGACCAATCCTA pLKO.1 948 5UTR 100% 3.000 2.100 N Spatc1 n/a
6 TRCN0000180126 CAGAGAAGATCATCCAGGCTT pLKO.1 1709 CDS 100% 2.640 1.848 N SPATC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316767.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.