Transcript: Mouse XM_017316889.1

PREDICTED: Mus musculus CD200 antigen (Cd200), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cd200 (17470)
Length:
2277
CDS:
326..940

Additional Resources:

NCBI RefSeq record:
XM_017316889.1
NBCI Gene record:
Cd200 (17470)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316889.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348625 TACTGGAAACGTCACCGAAAT pLKO_005 875 CDS 100% 10.800 15.120 N Cd200 n/a
2 TRCN0000066680 GCATCCTTACGATGTTCTCTA pLKO.1 242 5UTR 100% 4.950 6.930 N Cd200 n/a
3 TRCN0000348626 TAATCCAGCCTGCCTACAAAG pLKO_005 357 CDS 100% 10.800 8.640 N Cd200 n/a
4 TRCN0000066681 CGAGAGTCACTTCCATTCAAA pLKO.1 652 CDS 100% 5.625 4.500 N Cd200 n/a
5 TRCN0000419472 GTCTGTTGTAGGACTTGATTT pLKO_005 1148 3UTR 100% 13.200 9.240 N CD200 n/a
6 TRCN0000066678 CCTGCCTACAAAGACAGGATA pLKO.1 365 CDS 100% 4.950 3.465 N Cd200 n/a
7 TRCN0000066679 GCCCATAGTACACCTTCACTA pLKO.1 529 CDS 100% 4.950 3.465 N Cd200 n/a
8 TRCN0000335504 GCCCATAGTACACCTTCACTA pLKO_005 529 CDS 100% 4.950 3.465 N Cd200 n/a
9 TRCN0000066682 CAGAGTCTGGACAAAGGATTT pLKO.1 782 CDS 100% 10.800 6.480 N Cd200 n/a
10 TRCN0000335587 CAGAGTCTGGACAAAGGATTT pLKO_005 782 CDS 100% 10.800 6.480 N Cd200 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316889.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.