Transcript: Mouse XM_017316968.1

PREDICTED: Mus musculus DAZ interacting protein 3, zinc finger (Dzip3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dzip3 (224170)
Length:
4851
CDS:
218..3091

Additional Resources:

NCBI RefSeq record:
XM_017316968.1
NBCI Gene record:
Dzip3 (224170)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316968.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241732 CTGACATGGTCCGGCAAATAT pLKO_005 693 CDS 100% 15.000 21.000 N Dzip3 n/a
2 TRCN0000241730 GGGATGAAACAAGACGATATT pLKO_005 1100 CDS 100% 13.200 10.560 N Dzip3 n/a
3 TRCN0000434465 CTATCATCTGCTTCATATAAT pLKO_005 658 CDS 100% 15.000 10.500 N DZIP3 n/a
4 TRCN0000241733 TATGCCATTTGTCCATATATA pLKO_005 4670 3UTR 100% 15.000 10.500 N Dzip3 n/a
5 TRCN0000241731 ACTGATATTAGACCGAAATTC pLKO_005 578 CDS 100% 13.200 9.240 N Dzip3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316968.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02223 pDONR223 100% 68.7% 67.4% None (many diffs) n/a
2 ccsbBroad304_02223 pLX_304 0% 68.7% 67.4% V5 (many diffs) n/a
3 TRCN0000480525 AAGGTCATTAATAATACAACTAGC pLX_317 10.1% 68.7% 67.4% V5 (many diffs) n/a
Download CSV