Transcript: Mouse XM_017317159.1

PREDICTED: Mus musculus heart development protein with EGF-like domains 1 (Heg1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Heg1 (77446)
Length:
7722
CDS:
269..2956

Additional Resources:

NCBI RefSeq record:
XM_017317159.1
NBCI Gene record:
Heg1 (77446)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317159.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217203 CCTACACGTCCACTGTTAATA pLKO.1 765 CDS 100% 15.000 21.000 N Heg1 n/a
2 TRCN0000216212 CCAATCTTCCAAACCATAATG pLKO.1 3874 3UTR 100% 13.200 10.560 N Heg1 n/a
3 TRCN0000097250 CGGGACAGTATAACCCATCTT pLKO.1 2898 CDS 100% 4.950 3.960 N Heg1 n/a
4 TRCN0000097249 CGTGCTCATTTCCAAGCCAAT pLKO.1 3383 3UTR 100% 4.050 3.240 N Heg1 n/a
5 TRCN0000097251 CGAGCATGTGAAGATGGATAT pLKO.1 2459 CDS 100% 10.800 7.560 N Heg1 n/a
6 TRCN0000097253 CCAGTTCAACAAGATGGATCA pLKO.1 2431 CDS 100% 4.050 2.835 N Heg1 n/a
7 TRCN0000097252 CGGCAATATCAGCCATTGCAT pLKO.1 1089 CDS 100% 0.300 0.210 N Heg1 n/a
8 TRCN0000253691 AGCATGTGAAGATGGATATAG pLKO_005 2461 CDS 100% 13.200 7.920 N HEG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317159.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.