Transcript: Mouse XM_017317258.1

PREDICTED: Mus musculus histocompatibility 2, K1, K region (H2-K1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
H2-K1 (14972)
Length:
1238
CDS:
42..1223

Additional Resources:

NCBI RefSeq record:
XM_017317258.1
NBCI Gene record:
H2-K1 (14972)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317258.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314205 ACAGCAGACCTGAAGATAAAG pLKO_005 739 CDS 100% 13.200 9.240 N H2-K1 n/a
2 TRCN0000314144 CCTTGGAGCTGCAATAGTCAC pLKO_005 1040 CDS 100% 4.050 2.835 N H2-K1 n/a
3 TRCN0000066806 GCAGACCTGAAGATAAAGTCA pLKO.1 742 CDS 100% 3.000 2.100 N H2-K1 n/a
4 TRCN0000066807 AGCAGAGAGACTCAGGGCCTA pLKO.1 620 CDS 100% 0.720 0.432 N H2-K1 n/a
5 TRCN0000374453 GACGCGGAGAATCCGAGATAT pLKO_005 279 CDS 100% 13.200 6.600 Y H2-D1 n/a
6 TRCN0000066566 GCCCTGAACGAAGACCTGAAA pLKO.1 537 CDS 100% 4.950 2.475 Y H2-Q8 n/a
7 TRCN0000066805 CAGATACCTGAAGAACGGGAA pLKO.1 671 CDS 100% 2.160 1.080 Y H2-K1 n/a
8 TRCN0000318013 CAGATACCTGAAGAACGGGAA pLKO_005 671 CDS 100% 2.160 1.080 Y H2-K1 n/a
9 TRCN0000066803 GTATTACACATGCCATGTGTA pLKO.1 929 CDS 100% 0.495 0.248 Y H2-K1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317258.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.