Transcript: Mouse XM_017317354.1

PREDICTED: Mus musculus lysine (K)-specific demethylase 4B (Kdm4b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Kdm4b (193796)
Length:
5662
CDS:
331..3621

Additional Resources:

NCBI RefSeq record:
XM_017317354.1
NBCI Gene record:
Kdm4b (193796)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420198 TTCGGTGGACAGACGGTAATC pLKO_005 3278 CDS 100% 10.800 15.120 N Kdm4b n/a
2 TRCN0000103539 CCATCATTGAGGGCGTGAATA pLKO.1 830 CDS 100% 13.200 10.560 N Kdm4b n/a
3 TRCN0000103535 GCCCATGTGTACTTGGAAATT pLKO.1 4459 3UTR 100% 13.200 10.560 N Kdm4b n/a
4 TRCN0000418660 ACCGCAATGGGCTCTACTATC pLKO_005 3110 CDS 100% 10.800 7.560 N Kdm4b n/a
5 TRCN0000437391 GCAGCGATGGAAACTGAAATG pLKO_005 2859 CDS 100% 10.800 7.560 N Kdm4b n/a
6 TRCN0000018014 GCCCATCATCCTGAAGAAGTA pLKO.1 1071 CDS 100% 4.950 3.465 N KDM4B n/a
7 TRCN0000329961 GCCCATCATCCTGAAGAAGTA pLKO_005 1071 CDS 100% 4.950 3.465 N KDM4B n/a
8 TRCN0000103537 GCAGACATTCTACGAGGTCAA pLKO.1 3156 CDS 100% 4.050 2.835 N Kdm4b n/a
9 TRCN0000103538 GCCCATTATCCCAATGCTGTA pLKO.1 1884 CDS 100% 4.050 2.835 N Kdm4b n/a
10 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 5371 3UTR 100% 4.950 2.475 Y Gad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317354.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.