Transcript: Mouse XM_017317445.1

PREDICTED: Mus musculus scaffold attachment factor B (Safb), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Safb (224903)
Length:
2538
CDS:
1..2349

Additional Resources:

NCBI RefSeq record:
XM_017317445.1
NBCI Gene record:
Safb (224903)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317445.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000202546 CAAAGTTAAAGAGTCTCGAAA pLKO.1 1413 CDS 100% 4.950 6.930 N Safb n/a
2 TRCN0000241739 GATGACAAGGACACCGTTAAC pLKO_005 79 CDS 100% 10.800 8.640 N Safb n/a
3 TRCN0000187655 GCTATGGTTCGAACAAGAGAT pLKO.1 1991 CDS 100% 4.950 3.960 N Safb n/a
4 TRCN0000241741 AGGTGGGAATCCTGATGAAAT pLKO_005 5 CDS 100% 13.200 9.240 N Safb n/a
5 TRCN0000241738 AGTCCTGGAGCTCGCTGTTAT pLKO_005 922 CDS 100% 13.200 9.240 N Safb n/a
6 TRCN0000203761 CGGATCTGAAGAACCTGTTTA pLKO.1 854 CDS 100% 13.200 9.240 N Safb n/a
7 TRCN0000241737 CACAGAGACAGAGGCCGTTAT pLKO_005 1846 CDS 100% 10.800 7.560 N Safb n/a
8 TRCN0000241740 CCGTGACCTTCAAGTCCTATC pLKO_005 2367 3UTR 100% 6.000 4.200 N Safb n/a
9 TRCN0000203786 CACCTCAGAATGCAACAAGAA pLKO.1 32 CDS 100% 4.950 3.465 N Safb n/a
10 TRCN0000189158 GAGAAGAGCAAAGACGCAGAT pLKO.1 1195 CDS 100% 4.050 2.835 N Safb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317445.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.