Transcript: Mouse XM_017317508.1

PREDICTED: Mus musculus serine active site containing 1 (Serac1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Serac1 (321007)
Length:
3454
CDS:
146..1810

Additional Resources:

NCBI RefSeq record:
XM_017317508.1
NBCI Gene record:
Serac1 (321007)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317508.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181555 GCCCGAACTGAATGCTCTTAT pLKO.1 1597 CDS 100% 13.200 18.480 N Serac1 n/a
2 TRCN0000217865 GGCTGAATACTCCGTTAATAT pLKO.1 1672 CDS 100% 15.000 12.000 N Serac1 n/a
3 TRCN0000178600 CATGACTACCAGTACAGGATA pLKO.1 539 CDS 100% 4.950 3.465 N Serac1 n/a
4 TRCN0000176548 CGAAGCAAAGAAAGTGATCTT pLKO.1 602 CDS 100% 4.950 3.465 N Serac1 n/a
5 TRCN0000177140 GAAGTCAAAGAACTCAGCAAA pLKO.1 1718 CDS 100% 4.950 3.465 N Serac1 n/a
6 TRCN0000178100 GCACGAAGCAAAGAAAGTGAT pLKO.1 599 CDS 100% 4.950 3.465 N Serac1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317508.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09245 pDONR223 100% 71.6% 73.2% None (many diffs) n/a
Download CSV