Transcript: Mouse XM_017317895.1

PREDICTED: Mus musculus zinc finger protein 438 (Zfp438), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp438 (240186)
Length:
3120
CDS:
306..2507

Additional Resources:

NCBI RefSeq record:
XM_017317895.1
NBCI Gene record:
Zfp438 (240186)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317895.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418399 GTACACTGTGCGTAGTTATAT pLKO_005 2621 3UTR 100% 15.000 12.000 N Zfp438 n/a
2 TRCN0000086060 GTCTGCAACTACCACTTTCAA pLKO.1 1599 CDS 100% 5.625 4.500 N Zfp438 n/a
3 TRCN0000436639 AGCAACAGAGAGGGAATATAT pLKO_005 2894 3UTR 100% 15.000 10.500 N Zfp438 n/a
4 TRCN0000086058 CCTTTGAGTATGAGTGTGTAT pLKO.1 2809 3UTR 100% 4.950 3.465 N Zfp438 n/a
5 TRCN0000086059 GCAGTTCAGTTGCTCTCTGTA pLKO.1 909 CDS 100% 4.950 3.465 N Zfp438 n/a
6 TRCN0000086061 CCTTCCTCAATTTCTGACCAA pLKO.1 270 5UTR 100% 2.640 1.848 N Zfp438 n/a
7 TRCN0000086062 GAGATGGCATAGAAAGAGCAA pLKO.1 1294 CDS 100% 2.640 1.848 N Zfp438 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317895.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.