Transcript: Mouse XM_017317942.1

PREDICTED: Mus musculus ATPase, class II, type 9B (Atp9b), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atp9b (50771)
Length:
3528
CDS:
328..2589

Additional Resources:

NCBI RefSeq record:
XM_017317942.1
NBCI Gene record:
Atp9b (50771)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317942.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311201 TCCCATAAGTCTGCGAGTAAA pLKO_005 405 CDS 100% 13.200 18.480 N Atp9b n/a
2 TRCN0000304963 ACGGACACTATGGACGAAATC pLKO_005 619 CDS 100% 10.800 15.120 N Atp9b n/a
3 TRCN0000304961 AGCTGACAAAGGCGCTATTTC pLKO_005 281 5UTR 100% 13.200 9.240 N Atp9b n/a
4 TRCN0000101560 CGTCCTCTTCAGATGCAGTTT pLKO.1 2857 3UTR 100% 4.950 3.465 N Atp9b n/a
5 TRCN0000315562 CGTCCTCTTCAGATGCAGTTT pLKO_005 2857 3UTR 100% 4.950 3.465 N Atp9b n/a
6 TRCN0000101564 GCGATAAACTGGAAACAGCTA pLKO.1 1445 CDS 100% 2.640 1.848 N Atp9b n/a
7 TRCN0000051588 GCTTTCTTAGATGTTGCCTTT pLKO.1 2443 CDS 100% 4.050 2.835 N ATP9B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317942.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.