Transcript: Mouse XM_017317992.1

PREDICTED: Mus musculus carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9 (Chst9), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chst9 (71367)
Length:
2238
CDS:
699..1748

Additional Resources:

NCBI RefSeq record:
XM_017317992.1
NBCI Gene record:
Chst9 (71367)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317992.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103093 CGTCCAGTAGGAATGGATATT pLKO.1 1440 CDS 100% 13.200 10.560 N Chst9 n/a
2 TRCN0000103094 TGCAAGAAATATGGTAGAGTA pLKO.1 972 CDS 100% 4.950 3.960 N Chst9 n/a
3 TRCN0000103092 GCGTTTGAATACATATACCAA pLKO.1 1220 CDS 100% 3.000 2.400 N Chst9 n/a
4 TRCN0000103091 GCCGAAAGACAGCTCATCTAT pLKO.1 1674 CDS 100% 5.625 3.938 N Chst9 n/a
5 TRCN0000103090 GCAAGAAATATGGTAGAGTAA pLKO.1 973 CDS 100% 4.950 3.465 N Chst9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317992.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.