Transcript: Mouse XM_017318054.1

PREDICTED: Mus musculus cytochrome P450, family 2, subfamily c, polypeptide 38 (Cyp2c38), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cyp2c38 (13097)
Length:
1639
CDS:
36..1358

Additional Resources:

NCBI RefSeq record:
XM_017318054.1
NBCI Gene record:
Cyp2c38 (13097)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318054.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257570 ATGGAGACAGAGGTCTAGAAG pLKO_005 92 CDS 100% 4.950 6.930 N Cyp2c38 n/a
2 TRCN0000194373 CATTACCAGCTCTGCTTCATT pLKO.1 1329 CDS 100% 5.625 3.375 N Cyp2c38 n/a
3 TRCN0000193245 CGCTAATGGAAACTTTAAGAA pLKO.1 1127 CDS 100% 5.625 3.375 N Cyp2c38 n/a
4 TRCN0000250523 ATGTCATCTGCTCAATTATTT pLKO_005 412 CDS 100% 15.000 7.500 Y Cyp2c54 n/a
5 TRCN0000125825 CCCACTCCTTTCCCGATTATT pLKO.1 132 CDS 100% 15.000 7.500 Y Cyp2c39 n/a
6 TRCN0000125826 CCAAGGGAACAACAGTAGTAA pLKO.1 1030 CDS 100% 5.625 2.813 Y Cyp2c39 n/a
7 TRCN0000064107 CCTGTGACATTAAATTCAGAA pLKO.1 997 CDS 100% 4.950 2.475 Y CYP2C9 n/a
8 TRCN0000193255 CCTGTGACATTAAATTCAGAA pLKO.1 997 CDS 100% 4.950 2.475 Y Cyp2c38 n/a
9 TRCN0000125828 GCAGTGAAGGAAGCTCTGATT pLKO.1 279 CDS 100% 4.950 2.475 Y Cyp2c39 n/a
10 TRCN0000126973 GCCCTATACTGATGCCATGAT pLKO.1 920 CDS 100% 4.950 2.475 Y Cyp2c50 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318054.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.