Transcript: Mouse XM_017318168.1

PREDICTED: Mus musculus actin filament associated protein 1-like 2 (Afap1l2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Afap1l2 (226250)
Length:
4145
CDS:
426..3122

Additional Resources:

NCBI RefSeq record:
XM_017318168.1
NBCI Gene record:
Afap1l2 (226250)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318168.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420860 GCAAACGGAGCTTCGGTTAAG pLKO_005 3263 3UTR 100% 10.800 15.120 N Afap1l2 n/a
2 TRCN0000105863 GCTCAAGATCACACCGATGAA pLKO.1 1277 CDS 100% 4.950 6.930 N Afap1l2 n/a
3 TRCN0000105861 CCACCTGTATTCCTTCCGTAT pLKO.1 1793 CDS 100% 4.050 5.670 N Afap1l2 n/a
4 TRCN0000417027 TGGCAATGTTGAGGTTTAAAT pLKO_005 3523 3UTR 100% 15.000 10.500 N Afap1l2 n/a
5 TRCN0000105862 CCTGTTGAGATGCACAGATAA pLKO.1 2756 CDS 100% 13.200 9.240 N Afap1l2 n/a
6 TRCN0000418741 GAATTGCCTAAAGACTCTTAT pLKO_005 3130 3UTR 100% 13.200 9.240 N Afap1l2 n/a
7 TRCN0000437765 TGACCAGTGCAGAGATCAAAC pLKO_005 2605 CDS 100% 10.800 7.560 N Afap1l2 n/a
8 TRCN0000105864 GCCATTTGACAGATCCATCAA pLKO.1 863 CDS 100% 4.950 3.465 N Afap1l2 n/a
9 TRCN0000423611 GGAGAAGCAAGTGCGGAAGAA pLKO_005 1247 CDS 100% 4.950 3.465 N AFAP1L2 n/a
10 TRCN0000105860 CCCTTATCTTTCATCCTGTAT pLKO.1 3501 3UTR 100% 4.950 2.970 N Afap1l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318168.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.