Transcript: Mouse XM_017318301.1

PREDICTED: Mus musculus basic leucine zipper transcription factor, ATF-like 2 (Batf2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Batf2 (74481)
Length:
1501
CDS:
196..1020

Additional Resources:

NCBI RefSeq record:
XM_017318301.1
NBCI Gene record:
Batf2 (74481)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318301.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095806 CAGCACGAATCCTTGGAGAAA pLKO.1 331 CDS 100% 4.950 3.960 N Batf2 n/a
2 TRCN0000095807 GCACGAATCCTTGGAGAAACA pLKO.1 333 CDS 100% 4.950 3.960 N Batf2 n/a
3 TRCN0000095808 GCCAAGCAACCCTCAGGACAA pLKO.1 496 CDS 100% 1.350 1.080 N Batf2 n/a
4 TRCN0000233455 AGTACCTGCACACCAACATTG pLKO_005 1231 3UTR 100% 10.800 7.560 N Batf2 n/a
5 TRCN0000233452 TTCACAGAACAGAGAGCATTT pLKO_005 891 CDS 100% 10.800 7.560 N Batf2 n/a
6 TRCN0000095804 GCCAAGTGCAAGAACATTGAA pLKO.1 1158 3UTR 100% 5.625 3.938 N Batf2 n/a
7 TRCN0000233453 ACTCATTGGCAGAAGTCATCT pLKO_005 934 CDS 100% 4.950 3.465 N Batf2 n/a
8 TRCN0000233454 AGTCCACTTCTAGCCTATGTC pLKO_005 1008 CDS 100% 4.950 3.465 N Batf2 n/a
9 TRCN0000095805 CCACTCATTGGCAGAAGTCAT pLKO.1 932 CDS 100% 4.950 3.465 N Batf2 n/a
10 TRCN0000233451 GGGTCTTTCTCTAAGCTTGAT pLKO_005 754 CDS 100% 4.950 3.465 N Batf2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318301.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.