Transcript: Mouse XM_017318507.1

PREDICTED: Mus musculus connector enhancer of kinase suppressor of Ras 2 (Cnksr2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cnksr2 (245684)
Length:
5383
CDS:
474..3335

Additional Resources:

NCBI RefSeq record:
XM_017318507.1
NBCI Gene record:
Cnksr2 (245684)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318507.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025050 GCATCCCTATACTGGTATATT pLKO.1 2037 CDS 100% 15.000 21.000 N Cnksr2 n/a
2 TRCN0000362681 TCCTCCTGCAGAACCATATAT pLKO_005 1391 CDS 100% 15.000 21.000 N Cnksr2 n/a
3 TRCN0000025051 GCCATTATTGATAAAGTCCTA pLKO.1 3138 CDS 100% 2.640 3.696 N Cnksr2 n/a
4 TRCN0000362680 AGAATATCGAAAGAGGTTTAA pLKO_005 1517 CDS 100% 13.200 9.240 N Cnksr2 n/a
5 TRCN0000362682 ATGAAACTTCAACCGTAAATC pLKO_005 3689 3UTR 100% 13.200 9.240 N Cnksr2 n/a
6 TRCN0000025052 GCAACAGGATTGCACTGTATA pLKO.1 986 CDS 100% 13.200 9.240 N Cnksr2 n/a
7 TRCN0000025049 CCACTAAGTATCTCTTCTGAA pLKO.1 3255 CDS 100% 4.950 3.465 N Cnksr2 n/a
8 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 2866 CDS 100% 4.050 2.025 Y Myt1 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4174 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 2871 CDS 100% 4.950 2.475 Y PTMA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318507.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.