Transcript: Mouse XM_017318620.1

PREDICTED: Mus musculus RIKEN cDNA 5430427O19 gene (5430427O19Rik), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
5430427O19Rik (71398)
Length:
2176
CDS:
351..1247

Additional Resources:

NCBI RefSeq record:
XM_017318620.1
NBCI Gene record:
5430427O19Rik (71398)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318620.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000352568 CATGACGAATGTAGATCAAAT pLKO_005 1085 CDS 100% 13.200 18.480 N 5430427O19Rik n/a
2 TRCN0000341490 TAACTCAGTAATGGCAAATTT pLKO_005 761 CDS 100% 15.000 10.500 N 5430427O19Rik n/a
3 TRCN0000341422 TTGGAATTGTGCATCTTATAA pLKO_005 401 CDS 100% 15.000 10.500 N 5430427O19Rik n/a
4 TRCN0000341423 CTTTAGCTGCAGTTGGTATAT pLKO_005 637 CDS 100% 13.200 9.240 N 5430427O19Rik n/a
5 TRCN0000341424 ATGAATCCCAAGGCACTATTG pLKO_005 1278 3UTR 100% 10.800 7.560 N 5430427O19Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318620.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09021 pDONR223 100% 85% 83.3% None (many diffs) n/a
2 ccsbBroad304_09021 pLX_304 0% 85% 83.3% V5 (many diffs) n/a
3 TRCN0000479436 TGAAGCACCCCTAAAAATAATAAA pLX_317 13.4% 85% 83.3% V5 (many diffs) n/a
Download CSV