Transcript: Mouse XM_017318644.1

PREDICTED: Mus musculus testis expressed gene 16 (Tex16), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tex16 (83556)
Length:
5536
CDS:
98..4993

Additional Resources:

NCBI RefSeq record:
XM_017318644.1
NBCI Gene record:
Tex16 (83556)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318644.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246901 GCCCTAGAAATACGATGATAA pLKO_005 3915 CDS 100% 13.200 18.480 N Tex16 n/a
2 TRCN0000246900 ACCTCTAATGTATCATCATTT pLKO_005 2798 CDS 100% 13.200 10.560 N Tex16 n/a
3 TRCN0000257598 AGTCCCTAGTTTCGATGTTAT pLKO_005 4861 CDS 100% 13.200 10.560 N Tex16 n/a
4 TRCN0000192892 GCAGAGTATGGAATTAGGAAA pLKO.1 5224 3UTR 100% 4.950 3.960 N Tex16 n/a
5 TRCN0000217675 GGTAGAGCATCAGTATCTAAA pLKO.1 1664 CDS 100% 13.200 9.240 N Tex16 n/a
6 TRCN0000257754 GGTAGAGCATCAGTATCTAAA pLKO_005 1664 CDS 100% 13.200 9.240 N Tex16 n/a
7 TRCN0000246899 GTGTTCCCTGAACAATGTTTA pLKO_005 5084 3UTR 100% 13.200 9.240 N Tex16 n/a
8 TRCN0000189623 CCAAGAAGGTTCTGAGGAGAT pLKO.1 5037 3UTR 100% 4.050 2.835 N Tex16 n/a
9 TRCN0000201222 GATGTTATAGTGGAAGCTGAA pLKO.1 4874 CDS 100% 4.050 2.835 N Tex16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318644.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.