Transcript: Mouse XM_017318648.1

PREDICTED: Mus musculus oligophrenin 1 (Ophn1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ophn1 (94190)
Length:
6324
CDS:
16..2190

Additional Resources:

NCBI RefSeq record:
XM_017318648.1
NBCI Gene record:
Ophn1 (94190)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318648.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113071 GCGGAATCATTCAAGGAATTT pLKO.1 31 CDS 100% 13.200 18.480 N Ophn1 n/a
2 TRCN0000317723 GCGGAATCATTCAAGGAATTT pLKO_005 31 CDS 100% 13.200 18.480 N Ophn1 n/a
3 TRCN0000350063 GGGATATCCTGGGCGAAATAC pLKO_005 622 CDS 100% 13.200 18.480 N Ophn1 n/a
4 TRCN0000113072 GCGAAATACTATTGTCGGTAT pLKO.1 634 CDS 100% 4.050 5.670 N Ophn1 n/a
5 TRCN0000319532 CAGTGTCTGGGAACCTATAAA pLKO_005 2310 3UTR 100% 15.000 10.500 N Ophn1 n/a
6 TRCN0000319531 CTATTCACTCCCTAGTATATA pLKO_005 1232 CDS 100% 15.000 10.500 N Ophn1 n/a
7 TRCN0000382187 GGACATTGTTTACCTTATTTG pLKO_005 2613 3UTR 100% 13.200 9.240 N Ophn1 n/a
8 TRCN0000380261 TATCTACCACACTCCTATAAC pLKO_005 885 CDS 100% 13.200 9.240 N Ophn1 n/a
9 TRCN0000380230 TGTTAGGAAGTGCATCAATTT pLKO_005 948 CDS 100% 13.200 9.240 N Ophn1 n/a
10 TRCN0000113070 CGTGTTTGTTTCTCCTTTGTA pLKO.1 2354 3UTR 100% 5.625 3.938 N Ophn1 n/a
11 TRCN0000113073 GCTACTCCAAAGGCTTCCAAT pLKO.1 1831 CDS 100% 4.950 3.465 N Ophn1 n/a
12 TRCN0000113074 CCGAAGCCAATAGAAGGCTAT pLKO.1 836 CDS 100% 4.050 2.835 N Ophn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318648.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.