Transcript: Mouse XM_017318895.1

PREDICTED: Mus musculus vomeronasal 1 receptor Vmn1r187 (Vmn1r187), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vmn1r187 (100039499)
Length:
978
CDS:
76..978

Additional Resources:

NCBI RefSeq record:
XM_017318895.1
NBCI Gene record:
Vmn1r187 (100039499)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318895.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126887 CCAACTGACCTCAAATGTAAA pLKO.1 295 CDS 100% 13.200 6.600 Y Vmn1r180 n/a
2 TRCN0000425056 GAGCTCATATACTCTAAATTG pLKO_005 789 CDS 100% 13.200 6.600 Y Vmn1r63 n/a
3 TRCN0000127362 CATCCTTCTGTTTGTCCATAA pLKO.1 138 CDS 100% 10.800 5.400 Y Vmn1r62 n/a
4 TRCN0000438697 TCCATGGTGATTCACCTAAAC pLKO_005 661 CDS 100% 10.800 5.400 Y Vmn1r64 n/a
5 TRCN0000124526 CCAAGGTTGTAAGCTATTGTT pLKO.1 443 CDS 100% 5.625 2.813 Y Vmn1r63 n/a
6 TRCN0000124607 CACCAGAGAATGAACCACATA pLKO.1 688 CDS 100% 4.950 2.475 Y Vmn1r62 n/a
7 TRCN0000127359 CCCATGACATCATATTCCTAA pLKO.1 617 CDS 100% 4.950 2.475 Y Vmn1r62 n/a
8 TRCN0000124525 CCTCAAATGTAAACTTGCATA pLKO.1 303 CDS 100% 4.950 2.475 Y Vmn1r63 n/a
9 TRCN0000127360 TGCTGGTTGTTCAGTGTCTTA pLKO.1 472 CDS 100% 4.950 2.475 Y Vmn1r62 n/a
10 TRCN0000124528 CCACCAGAGAATGAACCACAT pLKO.1 687 CDS 100% 4.050 2.025 Y Vmn1r63 n/a
11 TRCN0000124527 GCGCATCATGTCAGTATGGAA pLKO.1 948 CDS 100% 3.000 1.500 Y Vmn1r63 n/a
12 TRCN0000202548 CAGTTTGTCACTCTTGTTCTT pLKO.1 385 CDS 100% 4.950 2.475 Y Vmn1r151 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318895.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.