Transcript: Mouse XM_017318921.1

PREDICTED: Mus musculus PRAME family member 9/15-like (LOC100041806), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
LOC100041806 (100041806)
Length:
2515
CDS:
109..1188

Additional Resources:

NCBI RefSeq record:
XM_017318921.1
NBCI Gene record:
LOC100041806 (100041806)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318921.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367172 GAGAATAGGATCCCTATATTT pLKO_005 606 CDS 100% 15.000 7.500 Y C87414 n/a
2 TRCN0000269611 CAAGATGAATGTGGAACAATA pLKO_005 1317 3UTR 100% 13.200 6.600 Y E330014E10Rik n/a
3 TRCN0000367174 CATGGGTCTTTGACTATTAAC pLKO_005 1829 3UTR 100% 13.200 6.600 Y C87414 n/a
4 TRCN0000216046 CTTATATGCTTTGGATCTTAT pLKO.1 1095 CDS 100% 13.200 6.600 Y AA792892 n/a
5 TRCN0000246844 CTTATATGCTTTGGATCTTAT pLKO_005 1095 CDS 100% 13.200 6.600 Y AA792892 n/a
6 TRCN0000367173 GTGAAGGTCCTTCCGAGATAT pLKO_005 493 CDS 100% 13.200 6.600 Y C87414 n/a
7 TRCN0000367107 CTTCATGAAACACGTCCATTT pLKO_005 918 CDS 100% 10.800 5.400 Y C87414 n/a
8 TRCN0000367175 GACCCACCAGACCAAGTTATC pLKO_005 652 CDS 100% 10.800 5.400 Y C87414 n/a
9 TRCN0000376272 TTATATGCTTTGGATCTTATG pLKO_005 1096 CDS 100% 10.800 5.400 Y C87414 n/a
10 TRCN0000376273 TCTATGACCAGGGCCCAATAC pLKO_005 1496 3UTR 100% 10.800 5.400 Y C87414 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318921.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.