Transcript: Mouse XM_017318923.1

PREDICTED: Mus musculus ribosomal protein L7A (Rpl7a), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rpl7a (27176)
Length:
1133
CDS:
104..733

Additional Resources:

NCBI RefSeq record:
XM_017318923.1
NBCI Gene record:
Rpl7a (27176)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194352 CGTTGCCTTCACACAGGTTAA pLKO.1 706 CDS 100% 10.800 6.480 N Rpl7a n/a
2 TRCN0000413019 AGCTATTAGGACCAATTATAA pLKO_005 949 3UTR 100% 15.000 7.500 Y Rpl7a n/a
3 TRCN0000217089 CTAAGCTGGTGGAAGCTATTA pLKO.1 936 3UTR 100% 13.200 6.600 Y Rpl7a n/a
4 TRCN0000173719 CTCCTGCCATTAACCAGTTCA pLKO.1 333 CDS 100% 4.950 2.475 Y Rpl7a n/a
5 TRCN0000176086 GCAAAGAGCTATCCTCTACAA pLKO.1 298 CDS 100% 4.950 2.475 Y Rpl7a n/a
6 TRCN0000193949 CTACTGCATCATCAAGGGAAA pLKO.1 643 CDS 100% 4.050 2.025 Y Rpl7a n/a
7 TRCN0000173384 GAGAAGAAAGCTGCTGGCAAA pLKO.1 458 CDS 100% 4.050 2.025 Y Rpl7a n/a
8 TRCN0000194463 GCTACTCAGCTGCTTAAGCTT pLKO.1 377 CDS 100% 3.000 1.500 Y Rpl7a n/a
9 TRCN0000175580 CAAGAGAAGAAGCAAAGGCTA pLKO.1 425 CDS 100% 2.640 1.320 Y Rpl7a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318923.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.