Transcript: Mouse XM_017318931.1

PREDICTED: Mus musculus Sycp3 like Y-linked (Sly), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sly (382301)
Length:
567
CDS:
1..567

Additional Resources:

NCBI RefSeq record:
XM_017318931.1
NBCI Gene record:
Sly (382301)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318931.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176799 CCAAAGGAAGGTTACTTATTA pLKO.1 37 CDS 100% 15.000 7.500 Y Sly n/a
2 TRCN0000256697 ACCAAAGGAAGGTTACTTATT pLKO_005 36 CDS 100% 13.200 6.600 Y Gm4297 n/a
3 TRCN0000256433 ATGATGAGGACGATGACATAA pLKO_005 71 CDS 100% 13.200 6.600 Y Gm20736 n/a
4 TRCN0000269988 CAAAGGAAGGTTACTTATTAC pLKO_005 38 CDS 100% 13.200 6.600 Y Gm5168 n/a
5 TRCN0000256434 GGAGGCTCTTTCGGAAGTAAA pLKO_005 102 CDS 100% 13.200 6.600 Y Gm20736 n/a
6 TRCN0000256432 TATAAGACGCTTCACATAAAG pLKO_005 229 CDS 100% 13.200 6.600 Y Gm20736 n/a
7 TRCN0000177348 GCAACCAGAAATTAGAAAGAT pLKO.1 293 CDS 100% 5.625 2.813 Y Sly n/a
8 TRCN0000178044 GCAGCAACCAGAAATTAGAAA pLKO.1 290 CDS 100% 5.625 2.813 Y Sly n/a
9 TRCN0000182043 CAAGCAGAAGCAGATGAAGAT pLKO.1 160 CDS 100% 4.950 2.475 Y Sly n/a
10 TRCN0000182183 CCTCAAGCAGAAGCAGATGAA pLKO.1 157 CDS 100% 4.950 2.475 Y Sly n/a
11 TRCN0000200173 CGAACGAGAGAGGAAGAACAT pLKO.1 327 CDS 100% 4.950 2.475 Y Sly n/a
12 TRCN0000181673 GCAGATGAAGATATGGGAGAT pLKO.1 169 CDS 100% 4.050 2.025 Y Sly n/a
13 TRCN0000256212 TACCAAAGGAAGGTTACTTAT pLKO_005 35 CDS 100% 0.000 0.000 Y Gm2030 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318931.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.