Transcript: Mouse XM_017319074.1

PREDICTED: Mus musculus zinc finger protein 663 (Zfp663), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp663 (381405)
Length:
4545
CDS:
1653..3515

Additional Resources:

NCBI RefSeq record:
XM_017319074.1
NBCI Gene record:
Zfp663 (381405)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319074.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095561 GCCGATACCATGACAACAAAT pLKO.1 1782 CDS 100% 13.200 18.480 N Zfp663 n/a
2 TRCN0000095559 GCCATCAGATTATACATGATA pLKO.1 3575 3UTR 100% 5.625 3.938 N Zfp663 n/a
3 TRCN0000095563 CGAAGATGTGTCTGTGGTCTT pLKO.1 1574 5UTR 100% 4.050 2.835 N Zfp663 n/a
4 TRCN0000095562 GCAGACACACAAACAGCCTTA pLKO.1 2643 CDS 100% 4.050 2.835 N Zfp663 n/a
5 TRCN0000095560 CCCTATAAAGAGAAATTGGAT pLKO.1 2418 CDS 100% 3.000 2.100 N Zfp663 n/a
6 TRCN0000155073 GAAGAAGAGAAAGAGGAGGAA pLKO.1 4419 3UTR 100% 2.640 1.584 N BCAN n/a
7 TRCN0000164599 CGGGAGAGAAACCCTATGAAT pLKO.1 3028 CDS 100% 5.625 2.813 Y ZNF570 n/a
8 TRCN0000108182 CGGGAGAGAAACCATACAAAT pLKO.1 3112 CDS 100% 13.200 6.600 Y ZNF782 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4312 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319074.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.