Transcript: Mouse XM_017319316.1

PREDICTED: Mus musculus ADP-ribosylation factor-like 5B (Arl5b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arl5b (75869)
Length:
6823
CDS:
243..671

Additional Resources:

NCBI RefSeq record:
XM_017319316.1
NBCI Gene record:
Arl5b (75869)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100938 CCTCACCCTAAGTTCAATCAA pLKO.1 554 CDS 100% 5.625 7.875 N Arl5b n/a
2 TRCN0000100936 CGCCTGGCTATTACGAAAGAA pLKO.1 423 CDS 100% 5.625 7.875 N Arl5b n/a
3 TRCN0000100937 GCCCATGAGGATTTAAGGAAA pLKO.1 462 CDS 100% 4.950 6.930 N Arl5b n/a
4 TRCN0000437427 ATCGGTGGTCAAGAATCTCTG pLKO_005 330 CDS 100% 4.050 5.670 N Arl5b n/a
5 TRCN0000380875 TGTTGGCCCATGAGGATTTAA pLKO_005 457 CDS 100% 15.000 12.000 N Arl5b n/a
6 TRCN0000382190 GTCATCCTGGAACACCTATTA pLKO_005 353 CDS 100% 13.200 10.560 N Arl5b n/a
7 TRCN0000379883 CGTTGTGAAGAACACTCATTT pLKO_005 296 CDS 100% 13.200 9.240 N Arl5b n/a
8 TRCN0000381810 ACCATGCTCTTTCCGAGATAC pLKO_005 1023 3UTR 100% 10.800 7.560 N Arl5b n/a
9 TRCN0000047935 GCAGTCCTTATCTTTGCAAAT pLKO.1 486 CDS 100% 10.800 7.560 N ARL5B n/a
10 TRCN0000047937 CCAACCATAGGAAGCAATGTT pLKO.1 267 CDS 100% 5.625 3.938 N ARL5B n/a
11 TRCN0000435741 TCTTAATGAATGAAGTAGTTC pLKO_005 238 5UTR 100% 4.950 3.465 N Arl5b n/a
12 TRCN0000100935 GCAGTGTTAATGGTTCCCAAA pLKO.1 2081 3UTR 100% 4.050 2.835 N Arl5b n/a
13 TRCN0000100939 CATTCTTGTTGTGGATAGCAT pLKO.1 392 CDS 100% 3.000 1.800 N Arl5b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.