Transcript: Mouse XM_017319330.1

PREDICTED: Mus musculus breast carcinoma amplified sequence 1 (Bcas1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Bcas1 (76960)
Length:
2794
CDS:
170..1864

Additional Resources:

NCBI RefSeq record:
XM_017319330.1
NBCI Gene record:
Bcas1 (76960)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319330.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217143 CGGAAGAAAGTAACGTGAAAG pLKO.1 1473 CDS 100% 10.800 7.560 N Bcas1 n/a
2 TRCN0000201670 GCTAGGACTCTCCTTTAGAAA pLKO.1 1198 CDS 100% 5.625 3.938 N Bcas1 n/a
3 TRCN0000200991 CACTCGTGTAATTCAACACTA pLKO.1 292 CDS 100% 4.950 3.465 N Bcas1 n/a
4 TRCN0000190879 CCAAGGATAATGTGGCTACTT pLKO.1 342 CDS 100% 4.950 3.465 N Bcas1 n/a
5 TRCN0000190820 GCTGTAAAGAAGAATGGGCAA pLKO.1 2360 3UTR 100% 2.160 1.512 N Bcas1 n/a
6 TRCN0000190701 GCCTACAACTTCAACCTGAAT pLKO.1 1974 3UTR 100% 4.950 2.970 N Bcas1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319330.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.