Transcript: Mouse XM_017319336.1

PREDICTED: Mus musculus euchromatic histone methyltransferase 1 (Ehmt1), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ehmt1 (77683)
Length:
4957
CDS:
27..3776

Additional Resources:

NCBI RefSeq record:
XM_017319336.1
NBCI Gene record:
Ehmt1 (77683)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319336.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414411 GAGAGCGTGGATCACGAATTG pLKO_005 1515 CDS 100% 10.800 15.120 N Ehmt1 n/a
2 TRCN0000416418 GTTCGGGAAGAGGACTCTTAC pLKO_005 3378 CDS 100% 10.800 15.120 N Ehmt1 n/a
3 TRCN0000086069 CCCTTGATCTTCGAGTGCAAT pLKO.1 3177 CDS 100% 4.950 6.930 N Ehmt1 n/a
4 TRCN0000086072 CCTGAGTTTAACATGGCAGAA pLKO.1 3153 CDS 100% 4.050 5.670 N Ehmt1 n/a
5 TRCN0000086068 CGCTATGATGATGATGAATAA pLKO.1 4427 3UTR 100% 13.200 9.240 N Ehmt1 n/a
6 TRCN0000435320 ACTATGATGTGGTTCAGTATC pLKO_005 2431 CDS 100% 10.800 7.560 N Ehmt1 n/a
7 TRCN0000433423 CAAACAGCGTGGTCAAGTATG pLKO_005 1546 CDS 100% 10.800 7.560 N Ehmt1 n/a
8 TRCN0000421714 CGTTGAGGACTCCCAACATTC pLKO_005 484 CDS 100% 10.800 7.560 N Ehmt1 n/a
9 TRCN0000086070 GCGCTGGCTATATGGAAGTTT pLKO.1 1306 CDS 100% 5.625 3.938 N Ehmt1 n/a
10 TRCN0000086071 GCAGAGAACAACCACTTGGAT pLKO.1 2319 CDS 100% 3.000 2.100 N Ehmt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319336.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.