Transcript: Mouse XM_017319358.1

PREDICTED: Mus musculus GTPase activating RANGAP domain-like 3 (Garnl3), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Garnl3 (99326)
Length:
3354
CDS:
383..2923

Additional Resources:

NCBI RefSeq record:
XM_017319358.1
NBCI Gene record:
Garnl3 (99326)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319358.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106231 GCGCCACATTGGAAACGATAT pLKO.1 760 CDS 100% 10.800 15.120 N Garnl3 n/a
2 TRCN0000106230 CCTATTGGCCATCCTTAGTTT pLKO.1 2933 3UTR 100% 5.625 7.875 N Garnl3 n/a
3 TRCN0000106233 CGTGCAATTCTTTGGCGGAAA pLKO.1 290 5UTR 100% 4.050 5.670 N Garnl3 n/a
4 TRCN0000416837 GTGGTTGCAATTCGCAATAAA pLKO_005 1685 CDS 100% 15.000 12.000 N Garnl3 n/a
5 TRCN0000106234 GCAGCTATTGATGTTTATGAA pLKO.1 1985 CDS 100% 5.625 3.938 N Garnl3 n/a
6 TRCN0000106232 CCCGTGTTTGACAGAACTCTA pLKO.1 1436 CDS 100% 4.950 3.465 N Garnl3 n/a
7 TRCN0000048310 GCCATATTCCAAAGAGAACAA pLKO.1 721 CDS 100% 4.950 3.465 N GARNL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319358.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15192 pDONR223 82.6% 74.8% 20% None (many diffs) n/a
2 ccsbBroad304_15192 pLX_304 0% 74.8% 20% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV