Transcript: Mouse XM_017319532.1

PREDICTED: Mus musculus dedicator of cytokinesis 10 (Dock10), transcript variant X13, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dock10 (210293)
Length:
6857
CDS:
252..6752

Additional Resources:

NCBI RefSeq record:
XM_017319532.1
NBCI Gene record:
Dock10 (210293)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319532.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265176 GAGTGGTGCTGAACCTTATAT pLKO_005 1811 CDS 100% 15.000 21.000 N Dock10 n/a
2 TRCN0000251514 TTGCCGTCCATACCGAGTATA pLKO_005 2243 CDS 100% 13.200 18.480 N Dock10 n/a
3 TRCN0000251515 TACCTAGGGAAACGCAATATA pLKO_005 4392 CDS 100% 0.000 0.000 N Dock10 n/a
4 TRCN0000251513 ATGACCCTGTAACCAATATTG pLKO_005 1492 CDS 100% 13.200 9.240 N Dock10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319532.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12236 pDONR223 100% 20.8% 22.5% None (many diffs) n/a
2 ccsbBroad304_12236 pLX_304 0% 20.8% 22.5% V5 (many diffs) n/a
3 TRCN0000473559 AACGGTCTGATACTATGCAAGGTC pLX_317 26.1% 20.8% 22.5% V5 (many diffs) n/a
Download CSV