Transcript: Mouse XM_017319673.1

PREDICTED: Mus musculus spermatogenesis associated 5 (Spata5), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Spata5 (57815)
Length:
2896
CDS:
1316..2728

Additional Resources:

NCBI RefSeq record:
XM_017319673.1
NBCI Gene record:
Spata5 (57815)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319673.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000027761 CCGGAAAGACAATGATTGCTA pLKO.1 1223 5UTR 100% 3.000 4.200 N Spata5 n/a
2 TRCN0000232409 GTTGAACTTTCTAGCTATAAA pLKO_005 2104 CDS 100% 15.000 12.000 N Spata5 n/a
3 TRCN0000232406 CCAGCGCCTAGAGGGTTATTA pLKO_005 1183 5UTR 100% 15.000 10.500 N Spata5 n/a
4 TRCN0000232407 GCAAGGTTACGCCAGATATTT pLKO_005 1343 CDS 100% 15.000 10.500 N Spata5 n/a
5 TRCN0000232408 GAAGTGAAGGACGGGTATTAG pLKO_005 1509 CDS 100% 13.200 9.240 N Spata5 n/a
6 TRCN0000232405 GACATGATTGGAGGCTTAAAC pLKO_005 1087 5UTR 100% 13.200 9.240 N Spata5 n/a
7 TRCN0000027708 CCTTGAAACATCCTAAGTCTT pLKO.1 1983 CDS 100% 4.950 3.465 N Spata5 n/a
8 TRCN0000027703 CGGCTTGATATTCTCCAGAAA pLKO.1 1631 CDS 100% 4.950 3.465 N Spata5 n/a
9 TRCN0000027738 GCCTGGAAGAATTGACAGGAT pLKO.1 2398 CDS 100% 2.640 1.584 N Spata5 n/a
10 TRCN0000027688 CCGATCAGTAACGAGGTTGAT pLKO.1 2486 CDS 100% 4.950 6.930 N Spata5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319673.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.