Transcript: Mouse XM_017319699.1

PREDICTED: Mus musculus chromodomain helicase DNA binding protein 1-like (Chd1l), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Chd1l (68058)
Length:
2854
CDS:
33..2579

Additional Resources:

NCBI RefSeq record:
XM_017319699.1
NBCI Gene record:
Chd1l (68058)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319699.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109405 CAAGGCTATCTTTGGTCATAT pLKO.1 2659 3UTR 100% 13.200 18.480 N Chd1l n/a
2 TRCN0000306303 GCGTTCATCTTCCACGAATTG pLKO_005 2401 CDS 100% 10.800 15.120 N Chd1l n/a
3 TRCN0000109408 CATCCCAACTTACATATACTA pLKO.1 2492 CDS 100% 5.625 7.875 N Chd1l n/a
4 TRCN0000109406 CCCAACTTACATATACTACTT pLKO.1 2495 CDS 100% 4.950 6.930 N Chd1l n/a
5 TRCN0000332243 CCCAACTTACATATACTACTT pLKO_005 2495 CDS 100% 4.950 6.930 N Chd1l n/a
6 TRCN0000306363 TGCTGACGACATACGAGATTT pLKO_005 460 CDS 100% 13.200 9.240 N Chd1l n/a
7 TRCN0000306302 TTTCAGCAACCAGTTAGATTC pLKO_005 2605 3UTR 100% 10.800 7.560 N Chd1l n/a
8 TRCN0000109409 GCAGAGAACAGGTGGAAGATT pLKO.1 691 CDS 100% 5.625 3.938 N Chd1l n/a
9 TRCN0000332244 GCAGAGAACAGGTGGAAGATT pLKO_005 691 CDS 100% 5.625 3.938 N Chd1l n/a
10 TRCN0000109407 GCAGCTTACCAACATGGTCAT pLKO.1 1319 CDS 100% 4.050 2.835 N Chd1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319699.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.