Transcript: Mouse XM_017319740.1

PREDICTED: Mus musculus TSC22 domain family, member 2 (Tsc22d2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tsc22d2 (72033)
Length:
2297
CDS:
154..2193

Additional Resources:

NCBI RefSeq record:
XM_017319740.1
NBCI Gene record:
Tsc22d2 (72033)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319740.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013519 CCGATGGACGTGTATGGAATA pLKO.1 651 CDS 100% 10.800 15.120 N TSC22D2 n/a
2 TRCN0000013521 CCACTTCTGTTACTATGCCAA pLKO.1 1688 CDS 100% 2.640 3.696 N TSC22D2 n/a
3 TRCN0000238118 TCTGTATTCAGCATAGCTATT pLKO_005 2035 CDS 100% 10.800 7.560 N Tsc22d2 n/a
4 TRCN0000369346 TCTGTATTCAGCATAGCTATT pLKO_005 2035 CDS 100% 10.800 7.560 N TSC22D2 n/a
5 TRCN0000013520 CCACTTTCTCTCATTGCTGAA pLKO.1 1933 CDS 100% 4.050 2.835 N TSC22D2 n/a
6 TRCN0000013522 GCTTTCTACCAAGCGTTCCAT pLKO.1 2092 CDS 100% 3.000 2.100 N TSC22D2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319740.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.