Transcript: Mouse XM_017319743.1

PREDICTED: Mus musculus ubiquitin specific peptidase 13 (isopeptidase T-3) (Usp13), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Usp13 (72607)
Length:
7051
CDS:
380..2209

Additional Resources:

NCBI RefSeq record:
XM_017319743.1
NBCI Gene record:
Usp13 (72607)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191296 CGTACTTGTTTGATTGATCTT pLKO.1 3473 3UTR 100% 4.950 6.930 N Usp13 n/a
2 TRCN0000192935 GCAACGAATCATAACCTGGAA pLKO.1 1871 CDS 100% 2.640 3.696 N Usp13 n/a
3 TRCN0000200627 CCATTATGTTTGCCATATCAA pLKO.1 2083 CDS 100% 5.625 3.938 N Usp13 n/a
4 TRCN0000192188 CCTTTCATCTATGCCTCAGTT pLKO.1 3704 3UTR 100% 4.950 3.465 N Usp13 n/a
5 TRCN0000201812 GCAACAGTTGCTACCTCAGTT pLKO.1 651 CDS 100% 4.950 3.465 N Usp13 n/a
6 TRCN0000007248 GCAGATAAAGAAGTTCACTTT pLKO.1 1375 CDS 100% 4.950 3.465 N USP13 n/a
7 TRCN0000297325 GCAGATAAAGAAGTTCACTTT pLKO_005 1375 CDS 100% 4.950 3.465 N USP13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.