Transcript: Mouse XM_017319878.1

PREDICTED: Mus musculus cytochrome P450, family 4, subfamily a, polypeptide 32 (Cyp4a32), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cyp4a32 (100040843)
Length:
1347
CDS:
51..1277

Additional Resources:

NCBI RefSeq record:
XM_017319878.1
NBCI Gene record:
Cyp4a32 (100040843)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319878.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282092 CAAAGGCGAACAAGAACTAAA pLKO_005 245 CDS 100% 13.200 9.240 N Cyp4a32 n/a
2 TRCN0000262101 GCTAATGGTATCTACAGATTG pLKO_005 393 CDS 100% 10.800 7.560 N Cyp4a32 n/a
3 TRCN0000262102 AGGACTCCTCAATAGAGATTT pLKO_005 583 CDS 100% 13.200 7.920 N Cyp4a32 n/a
4 TRCN0000262103 GATCCAAAGGCTAATGGTATC pLKO_005 384 CDS 100% 6.000 3.600 N Cyp4a32 n/a
5 TRCN0000262074 TTCGATTGATGCTAGACAAAT pLKO_005 544 CDS 100% 13.200 6.600 Y Cyp4a31 n/a
6 TRCN0000282078 CAGCCTTCCACTATGACATTC pLKO_005 490 CDS 100% 10.800 5.400 Y Cyp4a31 n/a
7 TRCN0000125891 CCCTGACTACATGAAAGTGAT pLKO.1 350 CDS 100% 4.950 2.475 Y Cyp4a10 n/a
8 TRCN0000125890 CCTGACTACATGAAAGTGATT pLKO.1 351 CDS 100% 4.950 2.475 Y Cyp4a10 n/a
9 TRCN0000191430 CCTGACTACATGAAAGTGATT pLKO.1 351 CDS 100% 4.950 2.475 Y Cyp4a31 n/a
10 TRCN0000125892 TCTTGTTGAATGGACAGCCAT pLKO.1 442 CDS 100% 2.640 1.320 Y Cyp4a10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319878.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.