Transcript: Mouse XM_017320001.1

PREDICTED: Mus musculus lysosomal-associated protein transmembrane 5 (Laptm5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Laptm5 (16792)
Length:
2538
CDS:
164..949

Additional Resources:

NCBI RefSeq record:
XM_017320001.1
NBCI Gene record:
Laptm5 (16792)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320001.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419714 CGACAGGATGGGTCATGATTG pLKO_005 1324 3UTR 100% 10.800 15.120 N Laptm5 n/a
2 TRCN0000102141 CGGTAAAGTGTCCTGTAGGTT pLKO.1 298 CDS 100% 3.000 4.200 N Laptm5 n/a
3 TRCN0000433911 CTACGAGGAAGCCTTGTCTCT pLKO_005 874 CDS 100% 2.640 3.696 N Laptm5 n/a
4 TRCN0000419565 CCTTCAAATAGCTTGCTTAAA pLKO_005 1397 3UTR 100% 13.200 9.240 N Laptm5 n/a
5 TRCN0000102142 GCACAGCCAGTTCATCAACAT pLKO.1 700 CDS 100% 4.950 3.465 N Laptm5 n/a
6 TRCN0000102143 GCTAGACTTCTGTTTGAGTAT pLKO.1 583 CDS 100% 4.950 3.465 N Laptm5 n/a
7 TRCN0000438704 CCCATACTCAGAAGTGTGATC pLKO_005 931 CDS 100% 4.050 2.835 N Laptm5 n/a
8 TRCN0000102144 GAAGCACATGAATTCGGCCAT pLKO.1 808 CDS 100% 0.000 0.000 N Laptm5 n/a
9 TRCN0000102140 GCTGTCCTTATCTTCAGTCAA pLKO.1 2081 3UTR 100% 4.950 2.970 N Laptm5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320001.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.